si:dkey-61p9.3

Ensembl ID:
ENSDARG00000068857
ZFIN IDs:
ZDB-GENE-041210-233, ZDB-GENE-060531-46
Description:
guanylate binding protein 4 [Source:RefSeq peptide;Acc:NP_001076414]
Human Orthologues:
GBP1, GBP2, GBP3, GBP4, GBP5, GBP6, GBP7
Human Descriptions:
guanylate binding protein 1, interferon-inducible, 67kDa [Source:HGNC Symbol;Acc:4182]
guanylate binding protein 2, interferon-inducible [Source:HGNC Symbol;Acc:4183]
guanylate binding protein 3 [Source:HGNC Symbol;Acc:4184]
guanylate binding protein 4 [Source:HGNC Symbol;Acc:20480]
guanylate binding protein 5 [Source:HGNC Symbol;Acc:19895]
guanylate binding protein 7 [Source:HGNC Symbol;Acc:29606]
guanylate binding protein family, member 6 [Source:HGNC Symbol;Acc:25395]
Mouse Orthologues:
AC113980.1, Gbp1, Gbp10, Gbp2, Gbp3, Gbp4, Gbp5, Gbp6, Gbp7, Gbp8, Gbp9
Mouse Descriptions:
guanylate binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:95666]
Guanylate binding protein 11 [Source:UniProtKB/TrEMBL;Acc:A9YVJ5]
guanylate binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:102772]
guanylate binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1926263]
guanylate binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:97072]
guanylate binding protein 5 Gene [Source:MGI Symbol;Acc:MGI:2429943]
guanylate binding protein 6 Gene [Source:MGI Symbol;Acc:MGI:2140937]
guanylate binding protein 7 Gene [Source:MGI Symbol;Acc:MGI:2444421]
guanylate-binding protein 10 Gene [Source:MGI Symbol;Acc:MGI:4359647]
guanylate-binding protein 8 Gene [Source:MGI Symbol;Acc:MGI:1923324]
guanylate-binding protein 9 Gene [Source:MGI Symbol;Acc:MGI:3605620]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20324 Essential Splice Site Available for shipment Available now
sa12852 Nonsense Available for shipment Available now
sa26369 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099727 Essential Splice Site 201 618 4 7
Genomic Location (Zv9):
Chromosome 4 (position 61422491)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76197415
GRCz11 4 77684122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTAACAGAGGATGAATATCTGGAGTTTGCGCTGAAGCTGAGGCCTGG[T/A]AATATATAAACACATTAATGCAGAATCTTTCACAATCACTATGAGCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12852
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099727 Nonsense 490 618 7 7
Genomic Location (Zv9):
Chromosome 4 (position 61424215)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76195691
GRCz11 4 77685846
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTCGAGCCAAACTTCTTCAAGGTCAGGAAGCTGYAGGTCGRTGATGYA[C/T]AAATGAATCTCGTCCGACAGAAAGACAAGATGTCTGTGTGGACGACCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099727 Nonsense 597 618 7 7
Genomic Location (Zv9):
Chromosome 4 (position 61424536)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76195370
GRCz11 4 77686167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGAAGATTTGTGACTCTGTGGATTCCAGTGGGAGGATAGCGAAATGT[A/T]AATTCATTGATATCCTTCAGGAAGAGGAGCGCTGCCTGCTTGAAGACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link