
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153310
- Ensembl ID:
- ENSDARG00000068851
- ZFIN ID:
- ZDB-GENE-060929-1090
- Description:
- hypothetical protein LOC767730 [Source:RefSeq peptide;Acc:NP_001070136]
- Human Orthologues:
- AC012313.1, RNF183
- Human Descriptions:
- ring finger protein 183 [Source:HGNC Symbol;Acc:28721]
- Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JWZ3]
- Mouse Orthologues:
- 2310014L17Rik, Rnf183
- Mouse Descriptions:
- RIKEN cDNA 2310014L17 gene Gene [Source:MGI Symbol;Acc:MGI:1924198]
- ring finger protein 183 Gene [Source:MGI Symbol;Acc:MGI:1923322]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32053 | Missense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32053
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099721 | Missense | 55 | 316 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 15 (position 34184237)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 35030013 GRCz11 15 34887982 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGACAAGCCTGTCAGGAGAAGCCGGAGCAATGACACGGAGAACCGGCGAC[G/A]TGAAGGCAGCCGAGGCAGAGAACGGGACCGGAGAGATGAAGGAAGACCAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: