zgc:153310

Ensembl ID:
ENSDARG00000068851
ZFIN ID:
ZDB-GENE-060929-1090
Description:
hypothetical protein LOC767730 [Source:RefSeq peptide;Acc:NP_001070136]
Human Orthologues:
AC012313.1, RNF183
Human Descriptions:
ring finger protein 183 [Source:HGNC Symbol;Acc:28721]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JWZ3]
Mouse Orthologues:
2310014L17Rik, Rnf183
Mouse Descriptions:
RIKEN cDNA 2310014L17 gene Gene [Source:MGI Symbol;Acc:MGI:1924198]
ring finger protein 183 Gene [Source:MGI Symbol;Acc:MGI:1923322]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32053 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa32053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099721 Missense 55 316 2 2
Genomic Location (Zv9):
Chromosome 15 (position 34184237)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35030013
GRCz11 15 34887982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAAGCCTGTCAGGAGAAGCCGGAGCAATGACACGGAGAACCGGCGAC[G/A]TGAAGGCAGCCGAGGCAGAGAACGGGACCGGAGAGATGAAGGAAGACCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link