si:dkey-29p23.1

Ensembl ID:
ENSDARG00000068841
ZFIN ID:
ZDB-GENE-081103-27
Human Orthologue:
NLRX1
Human Description:
NLR family member X1 [Source:HGNC Symbol;Acc:29890]
Mouse Orthologue:
Nlrx1
Mouse Description:
NLR family member X1 Gene [Source:MGI Symbol;Acc:MGI:2429611]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7323 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076870 Nonsense 49 313 2 4
ENSDART00000138679 Nonsense 82 741 3 5
Genomic Location (Zv9):
Chromosome 4 (position 39980150)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 43145233
GRCz11 4 43672748
KASP Assay ID:
554-4519.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACAAGAATTTCAAAGACAATCACAAAGACAATCTCCAATGGATCTTC[C/T]AGGTGGGAAAAACTMATTTTGATTCATTAAAGTCACTGAAATAACTCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link