trappc2

Ensembl ID:
ENSDARG00000068831
ZFIN ID:
ZDB-GENE-060929-1266
Description:
trafficking protein particle complex 2 [Source:RefSeq peptide;Acc:NP_001070243]
Human Orthologue:
TRAPPC2
Human Description:
trafficking protein particle complex 2 [Source:HGNC Symbol;Acc:23068]
Mouse Orthologues:
0610009B22Rik, Trappc2
Mouse Descriptions:
RIKEN cDNA 0610009B22 gene Gene [Source:MGI Symbol;Acc:MGI:1913300]
trafficking protein particle complex 2 Gene [Source:MGI Symbol;Acc:MGI:1913476]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38768 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099693 Essential Splice Site 32 140 2 5
Genomic Location (Zv9):
Chromosome 9 (position 56717847)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 55125663
GRCz11 9 54715176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTAATATTGTTATTAAAATATGATGATGATGTTGTTGATGATGTAAC[A/T]GGACGATCACAGACACCTAAATCAGTTCATCGCTCACGCTGCTCTGGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link