
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
h2afv
- Ensembl ID:
- ENSDARG00000068820
- ZFIN ID:
- ZDB-GENE-020717-1
- Description:
- Histone H2A.V [Source:UniProtKB/Swiss-Prot;Acc:Q71PD7]
- Human Orthologue:
- H2AFV
- Human Description:
- H2A histone family, member V [Source:HGNC Symbol;Acc:20664]
- Mouse Orthologue:
- H2afv
- Mouse Description:
- H2A histone family, member V Gene [Source:MGI Symbol;Acc:MGI:1924855]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40373 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40373
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099660 | Nonsense | 85 | 128 | 4 | 5 |
ENSDART00000139199 | None | 120 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 5 (position 14856565)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 13150423 GRCz11 5 13650640 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTTGGCAGGAAATGCTTCAAAAGACCTGAAGGTGAAGCGCATCACTCCT[C/T]GACATTTACAGCTGGCCATTCGAGGAGATGAGGAGCTCGATTCCCTTATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: