zgc:153073

Ensembl ID:
ENSDARG00000068784
ZFIN ID:
ZDB-GENE-060929-716
Description:
platelet receptor Gi24 [Source:RefSeq peptide;Acc:NP_001071049]
Human Orthologue:
C10orf54
Human Description:
chromosome 10 open reading frame 54 [Source:HGNC Symbol;Acc:30085]
Mouse Orthologue:
4632428N05Rik
Mouse Description:
RIKEN cDNA 4632428N05 gene Gene [Source:MGI Symbol;Acc:MGI:1921298]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31962 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099601 Essential Splice Site 142 275 2 7
Genomic Location (Zv9):
Chromosome 13 (position 43803973)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 43019089
GRCz11 13 43140852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAAGGAGCAGGAAGCCCATGACTTCATGTACCTCTCTGTGATGCCAA[G/A]TAAGCCAGTCAGAGAGTTCAGATCTGAGGTTCATGTATCCATACATGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link