si:dkey-77a20.5

Ensembl ID:
ENSDARG00000068745
ZFIN ID:
ZDB-GENE-070912-581
Description:
Kcnh2 protein [Source:UniProtKB/TrEMBL;Acc:Q0P425]
Human Orthologue:
MAP4
Human Description:
microtubule-associated protein 4 [Source:HGNC Symbol;Acc:6862]
Mouse Orthologue:
Mtap4
Mouse Description:
microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14589 Nonsense Available for shipment Available now
sa15378 Essential Splice Site Available for shipment Available now
sa13855 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099546 Nonsense 72 393 2 7
ENSDART00000123981 Nonsense 48 376 2 8
ENSDART00000125909 Nonsense 48 710 1 15
ENSDART00000132582   None 214 None 6
ENSDART00000138088   None 180 None 2
ENSDART00000140575   None 266 None 3
ENSDART00000144110   None 152 None 3
Genomic Location (Zv9):
Chromosome 2 (position 23675497)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24532998
GRCz11 2 24188649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACAGAGCTTTGATGATAAAGTGGGCGAGACTGTTGGRAAGACAGACTA[T/G]CGCCCCCTTCKGGATGGGATGGATGGGAAAAGAGAAGGTATGTCTTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099546 Essential Splice Site 352 393 6 7
ENSDART00000123981 Essential Splice Site 328 376 6 8
ENSDART00000125909 Essential Splice Site 328 710 5 15
ENSDART00000132582   None 214 None 6
ENSDART00000138088   None 180 None 2
ENSDART00000140575 Essential Splice Site 202 266 2 3
ENSDART00000144110   None 152 None 3
Genomic Location (Zv9):
Chromosome 2 (position 23644916)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24563579
GRCz11 2 24219230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAGCTAAYGGAAGCAAGGAGGTGACMAGWCCGGATAGTAAGACTAAG[G/A]TAAATGTAAAAAACAGATCTATATTTNATTCATCTAATGTGCTTCTGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13855
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099546   None 393 None 7
ENSDART00000123981   None 376 None 8
ENSDART00000125909 Nonsense 590 710 12 15
ENSDART00000132582 Nonsense 119 214 3 6
ENSDART00000138088   None 180 None 2
ENSDART00000140575   None 266 None 3
ENSDART00000144110   None 152 None 3
Genomic Location (Zv9):
Chromosome 2 (position 23625581)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24582914
GRCz11 2 24238565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATATTCTCAAAASAAGCTCTTTGCTCTTGTTCAACAGGTTCAGATTT[T/A]AAATAAGAAGGTTGACTTGAGCAAAGTGACCTCAAAATGTGGAWCCAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Blood pressure: Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link