
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-124k10.1
- Ensembl ID:
- ENSDARG00000068731
- ZFIN ID:
- ZDB-GENE-060531-8
- Description:
- Novel protein similar to vertebrate leucine-rich repeat-containing G protein-coupled receptor family
- Human Orthologue:
- RXFP2
- Human Description:
- relaxin/insulin-like family peptide receptor 2 [Source:HGNC Symbol;Acc:17318]
- Mouse Orthologue:
- Rxfp2
- Mouse Description:
- relaxin/insulin-like family peptide receptor 2 Gene [Source:MGI Symbol;Acc:MGI:2153463]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38488 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa40494 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa13404 | Nonsense | Available for shipment | Available now |
sa2221 | Nonsense | F2 line generated | During 2018 |
sa40493 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38488
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113765 | Nonsense | 166 | 393 | 6 | 15 |
ENSDART00000143448 | Nonsense | 96 | 622 | 4 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 37524862)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 35306811 GRCz11 5 35906964 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAACAGTATAGAAACGATCTCCAAGAGGGCATTTTCAGGACTGGTCGCTT[T/A]GCGTAAACTGTGAGTAATCTGTGAATGAATGACTCACTTAATGTGTGCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40494
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113765 | Nonsense | 372 | 393 | 15 | 15 |
ENSDART00000143448 | Nonsense | 302 | 622 | 13 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 37506308)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 35288257 GRCz11 5 35888410 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTGTGTTGAACAATTTCAGTTATTTCAAGCGTTTTGAATTCTGTGGATA[T/A]TCTCCAAATGTGCGGAGCTGCAAACCAAACACAGACGGAATCTCATCCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13404
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113765 | None | 393 | None | 15 | |
ENSDART00000143448 | Nonsense | 342 | 622 | 13 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 37506190)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 35288139 GRCz11 5 35888292 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACATCATTCTGCGGGTGTTTGTCTGGGTWGTCGCCTTCATCATTTGCTTC[G/T]GAAACATCTTCGTCATCTGTCTGCGGTCCTGTATTKCTTCAGAGAATYAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2221
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113765 | None | 393 | None | 15 | |
ENSDART00000143448 | Nonsense | 358 | 622 | 13 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 37506142)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 35288091 GRCz11 5 35888244 - KASP Assay ID:
- 554-2779.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCGGAAACATCTTCGTCATCTGTCTGCGGTCCTGTATTGCTTCAGAGAAT[C/T]AACATCACACCATGGCCATCAAATCCCTTTGCTGTGAGTCTATTATACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40493
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113765 | None | 393 | None | 15 | |
ENSDART00000143448 | Nonsense | 612 | 622 | 16 | 16 |
- Genomic Location (Zv9):
- Chromosome 5 (position 37493018)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 35274967 GRCz11 5 35875120 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCCCATCCTGTACACAATCACAACCAGCGCGTTTCAGCAGCGACTTAAA[C/T]AGTGTCTGAAATATCGCTGCCAGCAGACTAACTGACACAAACACACACTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: