e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153423
- Ensembl ID:
- ENSDARG00000068716
- ZFIN ID:
- ZDB-GENE-061027-344
- Description:
- hypothetical protein LOC768297 [Source:RefSeq peptide;Acc:NP_001070929]
- Human Orthologue:
- CUEDC1
- Human Description:
- CUE domain containing 1 [Source:HGNC Symbol;Acc:31350]
- Mouse Orthologue:
- Cuedc1
- Mouse Description:
- CUE domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2144281]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa14130 | Essential Splice Site | Available for shipment | Available now |
| sa34959 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa14130
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000099487 | Essential Splice Site | 259 | 380 | 6 | 11 |
| ENSDART00000114909 | None | 380 | None | 11 | |
| ENSDART00000131777 | Essential Splice Site | 260 | 381 | 6 | 11 |
The following transcripts of ENSDARG00000068716 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 38492711)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 37215726 GRCz11 10 37159484 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAACACACAGTGTGGTCATTCATCTGCTTGCACGGAGAACTCAGCCGAAG[G/T]TAGATTCCCTTCATCTTCATCCATCAGCCACGCATATACACCAGCTTTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34959
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000099487 | Essential Splice Site | 337 | 380 | None | 11 |
| ENSDART00000114909 | Essential Splice Site | 337 | 380 | None | 11 |
| ENSDART00000131777 | Essential Splice Site | 338 | 381 | None | 11 |
The following transcripts of ENSDARG00000068716 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 38493329)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 37216344 GRCz11 10 37160102 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGCTCATGTTTCCAGCCTTGACAGTCACTGCCAGAGGGTTGCGCCTACG[T/C]ATGTTGTGTAGAGATGTCAATGCTAACGTGCTTGCGTGTGTGTGTGTGTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Multiple sclerosis--Brain Glutamate Levels: Genetic variation influences glutamate concentrations in brains of patients with multiple sclerosis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
