zgc:158417

Ensembl ID:
ENSDARG00000068706
ZFIN ID:
ZDB-GENE-061201-36
Description:
hypothetical protein LOC780838 [Source:RefSeq peptide;Acc:NP_001073127]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7019 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099468 Nonsense 198 220 3 4
ENSDART00000100461 Nonsense 198 220 3 5
ENSDART00000121438 Nonsense 198 321 2 3
Genomic Location (Zv9):
Chromosome 6 (position 1418204)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 912411
GRCz11 6 1766780
KASP Assay ID:
554-5119.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGATYGAYAAGCTGCTGGAGGRGAATAAAGGAGRCGTCTTCATCCYA[C/T]AACATTACTATGAACTGATTCAGAAGRAGAATGATGAACGAGAAGTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link