
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gpr85
- Ensembl ID:
- ENSDARG00000068701
- ZFIN ID:
- ZDB-GENE-000710-2
- Description:
- Probable G protein-coupled receptor 85 [Source:UniProtKB/Swiss-Prot;Acc:Q9I919]
- Human Orthologue:
- GPR85
- Human Description:
- G protein-coupled receptor 85 [Source:HGNC Symbol;Acc:4536]
- Mouse Orthologue:
- Gpr85
- Mouse Description:
- G protein-coupled receptor 85 Gene [Source:MGI Symbol;Acc:MGI:1927851]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2156 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa2156
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099462 | Nonsense | 60 | 377 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 4 (position 6033936)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 6636480 GRCz11 4 6645050 - KASP Assay ID:
- 554-2786.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCGGAAACCTCCTGATATCCATCCTGCTGGTCAAAGACAAGAGCCTTCAT[C/T]GAGCGCCCKACTACTTCCTGCTGGACCTCTGTGCTTCGGACATCCTCCGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Attention deficit hyperactivity disorder and conduct disorder: Conduct disorder and ADHD: evaluation of conduct problems as a categorical and quantitative trait in the international multicentre ADHD genetics study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: