zgc:152951

Ensembl ID:
ENSDARG00000068663
ZFIN ID:
ZDB-GENE-060929-416
Description:
hypothetical protein LOC569013 [Source:RefSeq peptide;Acc:NP_001070644]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21459 Essential Splice Site Available for shipment Available now
sa399 Nonsense Available for shipment Available now
sa41393 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099396 Essential Splice Site 140 372 4 9
ENSDART00000138431 Essential Splice Site 140 372 4 9
Genomic Location (Zv9):
Chromosome 9 (position 19970982)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19345224
GRCz11 9 19352936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATCTGATCCTGAAACTTTACTCCGATCACCTCTCTGAAAATGGCAAGG[T/A]AACTCACTGCGTCAATCTCTCATCACATACTGCATATCAAATACATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099396 Nonsense 173 372 5 9
ENSDART00000138431 Nonsense 173 372 5 9
Genomic Location (Zv9):
Chromosome 9 (position 19970275)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19344517
GRCz11 9 19352229
KASP Assay ID:
554-0262.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTGATCTGGCTGTCAGACTTCAGCGTGTGGAGCTGCTCTCTATGAGT[C/T]GAGAAGAAAAACTGGCCTTCTTTATCAACATCTACAACGCACTTGTCATC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa41393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099396 Essential Splice Site 252 372 6 9
ENSDART00000138431 Essential Splice Site 252 372 6 9
Genomic Location (Zv9):
Chromosome 9 (position 19969952)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19344194
GRCz11 9 19351906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGGACAATTCCTGAAACCCTTCTCCAGGGATGACCCACGACTGCAGG[T/C]ATACTAGATAATTTATGGTTTGGTTTACTCAAAAAATTACTTGTTCAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link