
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:152951
- Ensembl ID:
- ENSDARG00000068663
- ZFIN ID:
- ZDB-GENE-060929-416
- Description:
- hypothetical protein LOC569013 [Source:RefSeq peptide;Acc:NP_001070644]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21459 | Essential Splice Site | Available for shipment | Available now |
sa399 | Nonsense | Available for shipment | Available now |
sa41393 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa21459
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099396 | Essential Splice Site | 140 | 372 | 4 | 9 |
ENSDART00000138431 | Essential Splice Site | 140 | 372 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 9 (position 19970982)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 19345224 GRCz11 9 19352936 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAATCTGATCCTGAAACTTTACTCCGATCACCTCTCTGAAAATGGCAAGG[T/A]AACTCACTGCGTCAATCTCTCATCACATACTGCATATCAAATACATATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa399
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099396 | Nonsense | 173 | 372 | 5 | 9 |
ENSDART00000138431 | Nonsense | 173 | 372 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 9 (position 19970275)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 19344517 GRCz11 9 19352229 - KASP Assay ID:
- 554-0262.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACTGTGATCTGGCTGTCAGACTTCAGCGTGTGGAGCTGCTCTCTATGAGT[C/T]GAGAAGAAAAACTGGCCTTCTTTATCAACATCTACAACGCACTTGTCATC
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa41393
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099396 | Essential Splice Site | 252 | 372 | 6 | 9 |
ENSDART00000138431 | Essential Splice Site | 252 | 372 | 6 | 9 |
- Genomic Location (Zv9):
- Chromosome 9 (position 19969952)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 19344194 GRCz11 9 19351906 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGGGACAATTCCTGAAACCCTTCTCCAGGGATGACCCACGACTGCAGG[T/C]ATACTAGATAATTTATGGTTTGGTTTACTCAAAAAATTACTTGTTCAAAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: