urah

Ensembl ID:
ENSDARG00000068644
ZFIN ID:
ZDB-GENE-060825-253
Description:
5-hydroxyisourate hydrolase [Source:UniProtKB/Swiss-Prot;Acc:Q06S87]
Human Orthologue:
AC133919.6
Human Description:
5-hydroxyisourate hydrolase pseudogene (LOC100130015), transcript variant 1, non-coding RNA [Source:
Mouse Orthologue:
1190003J15Rik
Mouse Description:
RIKEN cDNA 1190003J15 gene Gene [Source:MGI Symbol;Acc:MGI:1916142]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38826 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099370 Nonsense 8 138 1 4
Genomic Location (Zv9):
Chromosome 11 (position 11242359)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31038159
GRCz11 18 31016413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCTTATCAATTTAATTGCATTTTAGATGAACAGACTTCAACATATC[A/T]GAGGTCATATTGTTTCAGCAGATAAGGTAAGGTAACTTTTTTGAAATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link