zgc:152953

Ensembl ID:
ENSDARG00000068636
ZFIN ID:
ZDB-GENE-061103-607
Description:
hypothetical protein LOC571919 [Source:RefSeq peptide;Acc:NP_001073526]
Human Orthologue:
KIAA0649
Human Description:
KIAA0649 [Source:HGNC Symbol;Acc:29089]
Mouse Orthologue:
Gm347
Mouse Description:
predicted gene 347 Gene [Source:MGI Symbol;Acc:MGI:2685193]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35144 Nonsense Available for shipment Available now
sa41898 Nonsense Mutation detected in F1 DNA During 2018
sa16533 Nonsense Available for shipment Available now
sa24894 Nonsense Mutation detected in F1 DNA During 2018
sa45437 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099351 Nonsense 69 1004 2 3
Genomic Location (Zv9):
Chromosome 11 (position 38626991)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7547815
GRCz11 21 7109306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTGAGAGCCTTCACAGTACCCAGTCTTCGGGCATGAGTGAAAACGAG[C/T]AGGCTGAAAAGGCTGCTCATTCCAGTCACGAGGCTGGCTACAAGGGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099351 Nonsense 588 1004 3 3
Genomic Location (Zv9):
Chromosome 11 (position 38625106)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7549700
GRCz11 21 7111191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCGAGCAGAAGTGTATCCCACTCAACAGGCTTGTTAAATCTAGCATCT[T/A]GAAAGGTGGGAAAGAATCCCTGAACATTCAGGCTAAAAATGACAAGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099351 Nonsense 627 1004 3 3
Genomic Location (Zv9):
Chromosome 11 (position 38624990)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7549816
GRCz11 21 7111307
KASP Assay ID:
2260-4595.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAAGGCAAATGYGAGGTTCAAAACTTCAAGCCTTCTAAAAGCYTTGCG[C/T]AGACTGACAAGGTGACCGGGAATGGAGGRATTTCCTCAGCCCCAGGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099351 Nonsense 708 1004 3 3
Genomic Location (Zv9):
Chromosome 11 (position 38624747)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7550059
GRCz11 21 7111550
KASP Assay ID:
554-7605.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCATCAACTCCTCATCTGCAGAGACTGAGGAAAATCCAGATCTTCAA[A/T]AGACTCAAACTGAAACTCCAGTATCTGCTGCGACATCAACCTCCGGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099351 Nonsense 985 1004 3 3
Genomic Location (Zv9):
Chromosome 11 (position 38623915)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 7550891
GRCz11 21 7112382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCAAGGAAGATGAGGAAGAGAAATGTATTGATGAGACAGATGTAGAGT[C/A]AGATGAGGAAAGGAAAGATCAGAAGACAAAAGACACGAGCAAGCAGACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link