si:dkey-27p18.5

Ensembl ID:
ENSDARG00000068624
ZFIN ID:
ZDB-GENE-060531-133
Description:
Novel protein similar to spectrin, beta, erythrocytic (Sptb) [Source:UniProtKB/TrEMBL;Acc:A2BGE8]
Human Orthologue:
SPTBN4
Human Description:
spectrin, beta, non-erythrocytic 4 [Source:HGNC Symbol;Acc:14896]
Mouse Orthologue:
Spnb4
Mouse Description:
spectrin beta 4 Gene [Source:MGI Symbol;Acc:MGI:1890574]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8680 Nonsense Mutation detected in F1 DNA During 2018
sa30614 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40405 Nonsense Mutation detected in F1 DNA During 2018
sa40404 Nonsense Mutation detected in F1 DNA During 2018
sa6970 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099325 Nonsense 283 652 5 10
ENSDART00000133174 Nonsense 290 1412 5 19
Genomic Location (Zv9):
Chromosome 5 (position 24267464)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21980336
GRCz11 5 22484136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAGAGGTGGAGCTTGTGCGSGAGGGGGCGGGGCATGTGAGACAGCTGT[G/A]GGAGGTGCTTCAGGTGGAGATGGAACGCCGCACAGTGATGCTGGATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30614
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099325 Essential Splice Site 525 652 8 10
ENSDART00000133174 Essential Splice Site 532 1412 8 19
Genomic Location (Zv9):
Chromosome 5 (position 24262721)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21975593
GRCz11 5 22479393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGGCAGCATCCTACCAGCTGCACAAGTTCTTCACTGACTGTCAGGAG[G/A]TATACAGACTTGTACTATATACAGTTGTTATTTTAAATAATATTTCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099325 Nonsense 611 652 10 10
ENSDART00000133174 Nonsense 614 1412 10 19
Genomic Location (Zv9):
Chromosome 5 (position 24259455)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21972327
GRCz11 5 22476127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCGTGAGCAGGAAGTGATGCAGGCCTGGAAAGAGCTCCTCGTTGCATG[T/A]GAGGGCAGCCGTGTGCAGGTCACCACTGTAACCGATAAGATCCAGTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099325 Nonsense 644 652 10 10
ENSDART00000133174 Nonsense 647 1412 10 19
Genomic Location (Zv9):
Chromosome 5 (position 24259358)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21972230
GRCz11 5 22476030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTGCGGTGGTGCGGGAATTGAGCATGTGGATGGATGGAATCATGGGG[C/T]AGATTGGCCCAAATGACGATGCAAGGTACCAGATCATTTATAGAACTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099325   None 652 None 10
ENSDART00000133174 Nonsense 900 1412 14 19
Genomic Location (Zv9):
Chromosome 5 (position 24257428)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 21970300
GRCz11 5 22474100
KASP Assay ID:
554-5238.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCATGGGCTACAGCAGCCATCGGGGGTCGTCAATGAAAGTCCTTTATA[T/G]CAATCGATAAAACAACAGGGTGTTTCAAGTTTGGATAATTCCAGCTATMA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link