zgc:154018

Ensembl ID:
ENSDARG00000068613
ZFIN ID:
ZDB-GENE-060929-172
Description:
hypothetical protein LOC767791 [Source:RefSeq peptide;Acc:NP_001070226]
Human Orthologues:
CNKSR3, IPCEF1
Human Descriptions:
CNKSR family member 3 [Source:HGNC Symbol;Acc:23034]
interaction protein for cytohesin exchange factors 1 [Source:HGNC Symbol;Acc:21204]
Mouse Orthologues:
Cnksr3, Ipcef1
Mouse Descriptions:
Cnksr family member 3 Gene [Source:MGI Symbol;Acc:MGI:2674130]
interaction protein for cytohesin exchange factors 1 Gene [Source:MGI Symbol;Acc:MGI:2444159]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39267 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23629 Nonsense Available for shipment Available now
sa43375 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099298 Essential Splice Site 78 346 3 9
Genomic Location (Zv9):
Chromosome 20 (position 4262360)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149744.1 12675
GRCz11 20 4227344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGAGAGACTTCACTATAGAACAGGCTACCGAATGCAAGAAGAAATTG[T/A]AAGTTTGTCTTCATTATTTATAAAGATTGTTGGATACTTGGTGGGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099298 Nonsense 141 346 6 9
Genomic Location (Zv9):
Chromosome 20 (position 4273863)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149744.1 1172
GRCz11 20 4238847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGCGAAGAGAGTGACGATGAGGACGATGAAGAGATGTGTGTGGAGTA[T/A]ATGGATCAGCTGACCCCCGGCTCTCTGCATGTGAGTAACCAGATACACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099298 Essential Splice Site 270 346 9 9
Genomic Location (Zv9):
Chromosome 20 (position 4283005)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4512914
GRCz11 20 4247989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCATGTGATTCTCTCTGTCTCTGTATGTGTGTTCGTGCGGGGTTTCA[G/T]GCTAAGGAGGCTGATCTGCAGGCCATCGAGCAGGTTTTGAGTGAACCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link