
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
A5PL78_DANRE
- Ensembl ID:
- ENSDARG00000068589
- Description:
- LOC572200 protein [Source:UniProtKB/TrEMBL;Acc:A5PL78]
- Human Orthologues:
- NES, SYNM
- Human Descriptions:
- nestin [Source:HGNC Symbol;Acc:7756]
- synemin, intermediate filament protein [Source:HGNC Symbol;Acc:24466]
- Mouse Orthologues:
- Nes, Synm
- Mouse Descriptions:
- nestin Gene [Source:MGI Symbol;Acc:MGI:101784]
- synemin, intermediate filament protein Gene [Source:MGI Symbol;Acc:MGI:2661187]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16011 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16011
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099252 | Essential Splice Site | 126 | 240 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 21 (position 484760)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 337174 GRCz11 21 550648 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGACCAGATGAAGAGCAAGAAGGACGAGATCCTGACCTTCCACAAYCAG[G/A]TGAGCAACCTGAACCACAGATTAATAACTCGCTTTTTAACWCATGAGGTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: