
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
CDHR2 (1 of 2)
- Ensembl ID:
- ENSDARG00000068586
- Description:
- cadherin-related family member 2 [Source:HGNC Symbol;Acc:18231]
- Human Orthologues:
- CDH23, CDHR2
- Human Descriptions:
- cadherin-related 23 [Source:HGNC Symbol;Acc:13733]
- cadherin-related family member 2 [Source:HGNC Symbol;Acc:18231]
- Mouse Orthologue:
- Cdhr2
- Mouse Description:
- cadherin-related family member 2 Gene [Source:MGI Symbol;Acc:MGI:2687323]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39013 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa39013
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099244 | Essential Splice Site | 108 | 1102 | 5 | 25 |
- Genomic Location (Zv9):
- Chromosome 14 (position 47835680)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 45725790 GRCz11 14 50877022 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGTATTATTTTTAATTAATATTATGTTCATTATCATTCTCTCTCCTTC[A/T]GAACACTACTGTGGGCTTCGTACTGTTCACAGCAAGTGCCACAGACAGTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Vitiligo: Association analyses identify three susceptibility Loci for vitiligo in the Chinese Han population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: