
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-106k21.6
- Ensembl ID:
- ENSDARG00000068580
- ZFIN ID:
- ZDB-GENE-070912-8
- Human Orthologue:
- GLIS1
- Human Description:
- GLIS family zinc finger 1 [Source:HGNC Symbol;Acc:29525]
- Mouse Orthologue:
- Glis1
- Mouse Description:
- GLIS family zinc finger 1 Gene [Source:MGI Symbol;Acc:MGI:2386723]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19771 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19771
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099228 | Nonsense | 87 | 288 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 2 (position 26711888)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 26908084 GRCz11 2 26563718 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTCATCTTTGTAGCAAGAAGCTTCTAGACAAGGAAGAACTTTTCCAGTA[T/A]CGCAGCAGTGACTGCAAGGAGCATCTTAACTTTCACCATTTTCAGACAAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Response to statin therapy: Genome-wide association of lipid-lowering response to statins in combined study populations. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: