zgc:153394

Ensembl ID:
ENSDARG00000068551
ZFIN ID:
ZDB-GENE-060929-240
Description:
hypothetical protein LOC767653 [Source:RefSeq peptide;Acc:NP_001070061]
Human Orthologues:
ELOVL2, ELOVL4, ELOVL5
Human Descriptions:
elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 [Source:HGNC Symbol;A
elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 [Source:HGNC Symbol;A
ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) [Sour
Mouse Orthologues:
Elovl2, Elovl4, Elovl5
Mouse Descriptions:
elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 Gene [Source:MGI Symb
elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4 Gene [Source:MGI Symb
ELOVL family member 5, elongation of long chain fatty acids (yeast) Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39844 Nonsense Mutation detected in F1 DNA During 2018
sa19776 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099180 Nonsense 96 268 4 8

The following transcripts of ENSDARG00000068551 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 27552372)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27748568
GRCz11 2 27404202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTCATGTTTTGCTTTCAGTTCACAGCCTCCTCTTGGTTGGCAAGTTA[C/A]AGTTTGCTCTGTCAGCCTGTGGACTACACTGAAAACCCTCTGCCAATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099180 Nonsense 202 268 7 8

The following transcripts of ENSDARG00000068551 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 27557339)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27753535
GRCz11 2 27409169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATATGTATTATGGCCTGGCAGCGCTGGGCCCTCAGATGCAGAAATACT[T/G]ATGGTGGAAACGCTACCTCACTTCCCTCCAGCTGGTAAAACTCTTATTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aging: Linkage and association of successful aging to the 6q25 region in large Amish kindreds. (View Study)
  • Glaucoma: Genome-wide association study of normal tension glaucoma: common variants in SRBD1 and ELOVL5 contribute to disease susceptibility. (View Study)
  • Metabolic traits: Human metabolic individuality in biomedical and pharmaceutical research. (View Study)
  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)
  • Partial epilepsies: Common genetic variation and susceptibility to partial epilepsies: a genome-wide association study. (View Study)
  • Phospholipid levels (plasma): Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium. (View Study)
  • Sphingolipid levels: Genome-wide association study identifies novel loci associated with circulating phospho- and sphingolipid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link