v2rh14

Ensembl ID:
ENSDARG00000068520
ZFIN ID:
ZDB-GENE-050419-221
Description:
vomeronasal 2 receptor, h14 [Source:RefSeq peptide;Acc:NP_001076568]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6525 Nonsense Mutation detected in F1 DNA During 2018
sa36684 Nonsense Mutation detected in F1 DNA During 2018
sa13866 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6525
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099139 Nonsense 143 820 3 6
Genomic Location (Zv9):
Chromosome 18 (position 31570242)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33367101
GRCz11 18 33341696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTWAAATATATACATTATATAGGTTAGCTACTAWGCMACATGCTCCTG[T/A]TTAAGTGACCGGAGCAAATACYCMTCTTTCTTCAGAACAATTCCCAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099139 Nonsense 183 820 3 6
Genomic Location (Zv9):
Chromosome 18 (position 31570362)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33367221
GRCz11 18 33341816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTTCTGATCTTGAAGCACTTTGGATGGACCTGGGTTGGGCTCCTCTA[C/A]AGTGATGATGATTATGGCATCAATGCTGCTCAATCTTTCCAAAAGGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099139 Nonsense 738 820 6 6
Genomic Location (Zv9):
Chromosome 18 (position 31572610)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33369469
GRCz11 18 33344064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTATATTGGCATTTTAGCARCAGYAAGTTTTCTCTTAGCCTTCCTGGCA[C/T]GAAATTTACCAGATCATTTTAATGAGGCAAAGTTCATYACTTTTAGCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link