
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hapln1b
- Ensembl ID:
- ENSDARG00000068516
- ZFIN ID:
- ZDB-GENE-050920-1
- Human Orthologue:
- HAPLN1
- Human Description:
- hyaluronan and proteoglycan link protein 1 [Source:HGNC Symbol;Acc:2380]
- Mouse Orthologue:
- Hapln1
- Mouse Description:
- hyaluronan and proteoglycan link protein 1 Gene [Source:MGI Symbol;Acc:MGI:1337006]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa5834 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa41738 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa21814 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa5834
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062631 | Nonsense | 104 | 353 | 2 | 4 |
ENSDART00000142526 | Nonsense | 104 | 352 | 3 | 5 |
ENSDART00000146660 | None | 40 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 10 (position 44761190)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 43454778 GRCz10 KN150172.1 33120 GRCz11 10 43283158 GRCz11 KN150172.1 33120 - KASP Assay ID:
- 554-3729.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGAAGGAAAYTGAWGTGTTTGTGGCGATGGGCTTCCACAAAAAGAGCTA[C/A]GGTCGATTCCACGGCCGCGTTCACCTTCAGGCTGCCAGCGAGAGCGACGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41738
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062631 | Nonsense | 144 | 353 | 2 | 4 |
ENSDART00000142526 | Nonsense | 144 | 352 | 3 | 5 |
ENSDART00000146660 | None | 40 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 10 (position 44761071)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 43454659 GRCz10 KN150172.1 33001 GRCz11 10 43283039 GRCz11 KN150172.1 33001 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATCACCCTGGAGGATTACGGGAAATACAAGTGTGAAGTCATCGATGGCT[T/A]GGAGGACGATACGGCAGTGGTTTCTCTTGACCTACAAGGTAAAGCATGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21814
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000062631 | Nonsense | 233 | 353 | 3 | 4 |
ENSDART00000142526 | Nonsense | 233 | 352 | 4 | 5 |
ENSDART00000146660 | None | 40 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 10 (position 44756067)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 43449655 GRCz10 KN150172.1 28173 GRCz11 10 43278035 GRCz11 KN150172.1 28173 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCCCATCACCAAACCCAGAGAGCCATGTGGAGGCAAAAACACCATTCCC[G/T]GAGTCAGGAACTATGGGATACGAGACAAGCAAAAAGAACAATACGATGTC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Ankylosing spondylitis: A genome-wide association study in Han Chinese identifies new susceptibility loci for ankylosing spondylitis. (View Study)
- Prostate cancer: A genome-wide association study of breast and prostate cancer in the NHLBI's Framingham Heart Study. (View Study)
- Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: