zgc:162939

Ensembl ID:
ENSDARG00000068461
ZFIN ID:
ZDB-GENE-070410-115
Description:
aminopeptidase O [Source:RefSeq peptide;Acc:NP_001116730]
Human Orthologue:
C9orf3
Human Description:
chromosome 9 open reading frame 3 [Source:HGNC Symbol;Acc:1361]
Mouse Orthologue:
2010111I01Rik
Mouse Description:
RIKEN cDNA 2010111I01 gene Gene [Source:MGI Symbol;Acc:MGI:1919311]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41235 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21324 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111358 Essential Splice Site 483 787 5 16
ENSDART00000133209   None 45 None 4
ENSDART00000139864   None 45 None 6
ENSDART00000143809   None 45 None 7

The following transcripts of ENSDARG00000068461 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31132075)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30274801
GRCz11 8 30284033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCTTCGCTACTTACTTAGAGGATGTTTTCTGGAGCCACGTTCAGAAG[G/A]TATTATGATATGGTTGAATCTTTGAGTGCTTGTCTGAGGCCCTGTTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111358 Nonsense 575 787 8 16
ENSDART00000133209   None 45 None 4
ENSDART00000139864   None 45 None 6
ENSDART00000143809   None 45 None 7

The following transcripts of ENSDARG00000068461 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31110449)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30253175
GRCz11 8 30262407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTTTCTGGCTGATCAGATCGGCGAGGAGAAGTTCCTGCAATTCTTC[A/T]AAGTGTTTGTTGGAAAATTCCACGGGCAGCTAATTCTGTCTCAGGTGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link