nrg1

Ensembl ID:
ENSDARG00000068458
ZFIN ID:
ZDB-GENE-050302-113
Description:
pro-neuregulin-1, membrane-bound isoform [Source:RefSeq peptide;Acc:NP_001038376]
Human Orthologue:
NRG1
Human Description:
neuregulin 1 [Source:HGNC Symbol;Acc:7997]
Mouse Orthologue:
Nrg1
Mouse Description:
neuregulin 1 Gene [Source:MGI Symbol;Acc:MGI:96083]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45389 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099018   None 598 None 12
ENSDART00000114349   None 599 None 10
ENSDART00000122179   None 725 None 10
ENSDART00000123161   None 687 None 8
ENSDART00000124209   None 722 None 10
ENSDART00000129453 Nonsense 329 730 6 11

The following transcripts of ENSDARG00000068458 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 5893690)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7336857
GRCz11 10 7295557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCTTTCTTTTCATTACCTTGTCTGCCTTGGCAGAACATCTTGGGATT[G/T]AATTTATGGGTATGAATCGTTCTTTCCTCCTAGTTTGCAGATCCGTAGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac Troponin-T levels: Association of genome-wide variation with highly sensitive cardiac troponin-T levels in European Americans and Blacks: a meta-analysis from atherosclerosis risk in communities and cardiovascular health studies. (View Study)
  • Dialysis-related mortality: Genome-wide association scan for survival on dialysis in African-Americans with type 2 diabetes. (View Study)
  • Hip geometry: Genome-wide association with bone mass and geometry in the Framingham Heart Study. (View Study)
  • Hirschsprung's disease: Genome-wide association study identifies NRG1 as a susceptibility locus for Hirschsprung's disease. (View Study)
  • Thyroid cancer: Discovery of common variants associated with low TSH levels and thyroid cancer risk. (View Study)
  • Thyroid hormone levels: A meta-analysis of thyroid-related traits reveals novel loci and gender-specific differences in the regulation of thyroid function. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link