vgll4l

Ensembl ID:
ENSDARG00000068409
ZFIN ID:
ZDB-GENE-070112-1682
Description:
vestigial like 4 like [Source:RefSeq peptide;Acc:NP_001073467]
Human Orthologue:
VGLL4
Human Description:
vestigial like 4 (Drosophila) [Source:HGNC Symbol;Acc:28966]
Mouse Orthologue:
Vgll4
Mouse Description:
vestigial like 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2652840]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu3554 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu3554
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098925 Nonsense 177 266 5 5

The following transcripts of ENSDARG00000068409 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31948232)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31090958
GRCz11 8 31100190
KASP Assay ID:
554-0391.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGATTGTATCTCCACAGCTGTAAGCAAACACAGTTATGACCACGTC[G/T]AAGAGCATTTCCAGAGGAGCCTCGGCATTAACTACCACAGAGCCACGTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link