six9

Ensembl ID:
ENSDARG00000068407
ZFIN ID:
ZDB-GENE-990621-11
Description:
sine oculis homeobox homolog 9 [Source:RefSeq peptide;Acc:NP_001124080]
Human Orthologues:
SIX1, SIX2, SIX3, SIX6
Human Descriptions:
SIX homeobox 1 [Source:HGNC Symbol;Acc:10887]
SIX homeobox 2 [Source:HGNC Symbol;Acc:10888]
SIX homeobox 3 [Source:HGNC Symbol;Acc:10889]
SIX homeobox 6 [Source:HGNC Symbol;Acc:10892]
Mouse Orthologues:
Six1, Six2, Six3, Six6
Mouse Descriptions:
sine oculis-related homeobox 1 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:102780]
sine oculis-related homeobox 2 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:102778]
sine oculis-related homeobox 3 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:102764]
sine oculis-related homeobox 6 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1341840]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36698 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078064 Nonsense 211 235 3 3
ENSDART00000126421   221 221 3 3
Genomic Location (Zv9):
Chromosome 18 (position 35577684)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37256840
GRCz11 18 37237848
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGCGTTCTTGAGTTCAGATGAGGAGATCTCTCCTCCAGGAAGCCCC[A/T]GAACACTGTTCTCCTGCTCCCAGCAGCTCTCTGCCCACCCACCTCCTCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link