tbcb

Ensembl ID:
ENSDARG00000068404
ZFIN ID:
ZDB-GENE-030131-9296
Description:
tubulin folding cofactor B [Source:RefSeq peptide;Acc:NP_997940]
Human Orthologue:
TBCB
Human Description:
tubulin folding cofactor B [Source:HGNC Symbol;Acc:1989]
Mouse Orthologue:
Tbcb
Mouse Description:
tubulin folding cofactor B Gene [Source:MGI Symbol;Acc:MGI:1913661]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43153 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078053 Nonsense 45 246 3 7
ENSDART00000132577 Nonsense 45 72 2 2

The following transcripts of ENSDARG00000068404 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 35603992)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37283148
GRCz11 18 37264156
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGTCAATGAACCTAACTTGTATATTTGTTTTTCAGAGTAAACTGGAGT[T/A]GATTGTGGGCACTCCAGCTAGTTGTATGGACCTAGATCTGTTCAGCTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link