znf131

Ensembl ID:
ENSDARG00000068400
ZFIN IDs:
ZDB-GENE-040426-1563, ZDB-GENE-040426-1563
Description:
zinc finger protein 131 [Source:RefSeq peptide;Acc:NP_956799]
Human Orthologue:
ZNF131
Human Description:
zinc finger protein 131 [Source:HGNC Symbol;Acc:12915]
Mouse Orthologues:
Zfp131, Zfp131
Mouse Descriptions:
zinc finger protein 131 Gene [Source:MGI Symbol;Acc:MGI:1919715]
zinc finger protein 131 Gene [Source:MGI Symbol;Acc:MGI:1919715]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17774 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098912 Essential Splice Site 124 558 4 7
ENSDART00000098913 Essential Splice Site 124 467 4 8
Genomic Location (Zv9):
Chromosome 8 (position 32259794)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31402520
GRCz11 8 31411752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAGAATACCTTCAAATGCAGGAGGCAATCAAAGCCTTAAACAACAGG[T/C]TACTCKCATACTGCACTKACTATATTATTCAGACATTTTCTTCTCTCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link