si:dkey-3b8.4

Ensembl ID:
ENSDARG00000068398
ZFIN IDs:
ZDB-GENE-050419-24, ZDB-GENE-060531-22
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8DZ53]
Human Orthologue:
KIAA1377
Human Description:
KIAA1377 [Source:HGNC Symbol;Acc:29264]
Mouse Orthologue:
AK129341
Mouse Description:
cDNA sequence AK129341 Gene [Source:MGI Symbol;Acc:MGI:2680221]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29070 Nonsense Mutation detected in F1 DNA During 2018
sa29069 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36699 Nonsense Mutation detected in F1 DNA During 2018
sa43154 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098911 Nonsense 46 1084 2 12
ENSDART00000132315 Nonsense 23 1060 1 11
Genomic Location (Zv9):
Chromosome 18 (position 35747003)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37426159
GRCz11 18 37407167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAAACTGAAGATGAAAGGGAAGTGCTGTTACAGGAGCAGAGGTACTG[T/A]CGGGCTCGGGCTCGAAAGCTTTCTCTGGAAACTAATCGCAGAAGAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098911 Essential Splice Site 149 1084 None 12
ENSDART00000132315 Essential Splice Site 125 1060 None 11
Genomic Location (Zv9):
Chromosome 18 (position 35739771)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37418927
GRCz11 18 37399935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATACTCATCCATCTCAATTTTGGTCTGGTGCCTCCCCTGTTAGCAGG[T/C]ACGACATTACTGCCATCACAATATATCATAACGGGCAGAACTATTATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098911 Nonsense 636 1084 6 12
ENSDART00000132315 Nonsense 612 1060 5 11
Genomic Location (Zv9):
Chromosome 18 (position 35731174)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37410330
GRCz11 18 37391338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGGCGACCCCAACAGACATGCTAACCTGCCTCAACAAACCCATAAA[C/T]AGCTTTCTGCAGATCACTCGGACCATGTGAATTTACTCACAGGGGTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098911 Essential Splice Site 916 1084 7 12
ENSDART00000132315 Essential Splice Site 892 1060 6 11
Genomic Location (Zv9):
Chromosome 18 (position 35728378)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 37407534
GRCz11 18 37388542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAAAGGATCCTCAAGAATGGGGGGCTTTTTCTTGTCTTCCTCTAATG[G/A]TAAGGCTCTATAGGTTTATTTAATTAATGATGTCAAAGGGCATTCAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link