slc6a18

Ensembl ID:
ENSDARG00000068387
ZFIN ID:
ZDB-GENE-080219-9
Description:
solute carrier family 6, member 18 [Source:RefSeq peptide;Acc:NP_001108369]
Human Orthologue:
SLC6A18
Human Description:
solute carrier family 6, member 18 [Source:HGNC Symbol;Acc:26441]
Mouse Orthologue:
Slc6a18
Mouse Description:
solute carrier family 6 (neurotransmitter transporter), member 18 Gene [Source:MGI Symbol;Acc:MGI:13

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11153 Nonsense Available for shipment Available now
sa23402 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098881 Nonsense 276 618 6 12
Genomic Location (Zv9):
Chromosome 19 (position 630327)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 651814
GRCz11 19 651623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGTCTCTGGCCTTCGGTGGACTCATCGCTTTCTCCAGCTACAACCCC[A/T]AAAAGTACACARACACACACWTATATGCATTATAAYACATGATGTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098881 Essential Splice Site 320 618 8 12
Genomic Location (Zv9):
Chromosome 19 (position 628914)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 650401
GRCz11 19 650210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGAGCCGTTATTCAGAGTTTTGAGCCGCGTCTGCTGCTGTTGTGTTTC[A/G]GTAATATCCTGGACCTGACGAACGCTTTCGACATCGGCGACAGGAACATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link