zgc:152898

Ensembl ID:
ENSDARG00000068381
ZFIN ID:
ZDB-GENE-061103-202
Description:
Two pore calcium channel protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A0JMD4]
Human Orthologue:
TPCN2
Human Description:
two pore segment channel 2 [Source:HGNC Symbol;Acc:20820]
Mouse Orthologue:
Tpcn2
Mouse Description:
two pore segment channel 2 Gene [Source:MGI Symbol;Acc:MGI:2385297]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27083 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16019 Essential Splice Site Available for shipment Available now
sa14059 Essential Splice Site Available for shipment Available now
sa34225 Nonsense Mutation detected in F1 DNA During 2018
sa38652 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082690 Essential Splice Site 98 774 3 28
Genomic Location (Zv9):
Chromosome 7 (position 66333545)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54749489
GRCz11 7 55048829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGGTCCTTACGATTGTATAGATGGTACTACTCCAACTTATGTCAGTG[G/A]TAAGCAAACAAAAAATTATGTTTTTTTTTGTTTTGTTCAAACTACTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082690 Essential Splice Site 311 774 12 28
Genomic Location (Zv9):
Chromosome 7 (position 66344744)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54738290
GRCz11 7 55037630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCTAAACCGAGGCTATTCTATATTTTTCATACTCTTTAGTGTGTTTG[G/A]TAAGTTGCATGGTGTTCAGGTCATTGTCACTRTATACACAACATGCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14059
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082690 Essential Splice Site 397 774 15 28
Genomic Location (Zv9):
Chromosome 7 (position 66350368)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54732666
GRCz11 7 55032006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGGAGAGAGTCCACATGAARTCCTACTGCAGACAAGCTATCRTTAAG[G/A]TAAACACAGATCCTGGAATTGTTTGTTTAAATGTGTAGSYTAGATGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082690 Nonsense 705 774 26 28
Genomic Location (Zv9):
Chromosome 7 (position 66372519)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54710515
GRCz11 7 55009855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGTCAGCTGGTCTCTGGTGTACTTTGTGGTCTGGTGGTTGACATCTT[C/A]AGTCATGTGGGTCAACCTGTTTGTGGCACTCATTTTAGAGGTATGTAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082690 Nonsense 774 774 28 28
Genomic Location (Zv9):
Chromosome 7 (position 66377142)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 54705892
GRCz11 7 55005232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAGTTACTAGCTCAACTACATCAACATCCTCATCTCCACCTCTCCTG[G/A]TGACCCCCTCACCTCGGCCTTTAATACATAATTACACATACCCACAATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link