zgc:113405

Ensembl ID:
ENSDARG00000068323
ZFIN IDs:
ZDB-GENE-050320-140, ZDB-GENE-070112-1082
Description:
Novel protein similar to vertebrate astrotactin 1 (ASTN1, zgc:113405) [Source:UniProtKB/TrEMBL;Acc:B
Human Orthologue:
ASTN1
Human Description:
astrotactin 1 [Source:HGNC Symbol;Acc:773]
Mouse Orthologue:
Astn1
Mouse Description:
astrotactin 1 Gene [Source:MGI Symbol;Acc:MGI:1098567]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32958 Nonsense Mutation detected in F1 DNA During 2018
sa19808 Nonsense Available for shipment Available now
sa38341 Nonsense Mutation detected in F1 DNA During 2018
sa30598 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16944 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077216 Nonsense 375 1319 5 23
ENSDART00000098764   None 424 None 5
ENSDART00000134926   None 177 None 4
ENSDART00000141796   None 114 None 4
ENSDART00000145451   None 714 None 13
Genomic Location (Zv9):
Chromosome 2 (position 34435441)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 34732151
GRCz11 2 34714608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGAGACTCTGGGACAGAGGCGGACAGCGAGCCTCAGCTGACTTTCTA[C/A]ACCGACCCAAACCGCAGCCGCCGACGCAGTCGAGGTATGAGAAATGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19808
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077216 Nonsense 437 1319 6 23
ENSDART00000098764 Nonsense 387 424 5 5
ENSDART00000134926   None 177 None 4
ENSDART00000141796   None 114 None 4
ENSDART00000145451   None 714 None 13
Genomic Location (Zv9):
Chromosome 2 (position 34440926)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 34737636
GRCz11 2 34720093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGATCGGCCTGGTCTGTGCGTCTCACCTTTCCTGTAGCCTGAACGTC[A/T]GAGTGATCCTTCACGTACCGGAGCATCTCATTGCAGACGGTAATCTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077216 Nonsense 613 1319 11 23
ENSDART00000098764   None 424 None 5
ENSDART00000134926   None 177 None 4
ENSDART00000141796   None 114 None 4
ENSDART00000145451 Nonsense 9 714 1 13
Genomic Location (Zv9):
Chromosome 2 (position 34488027)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 34784737
GRCz11 2 34767194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGTGGCTTTTTCTATGTTCATCAGGGAGGAACTGATGATTTCCTCAT[C/A]ATTTGACAGTCTGGAGGTGCTGCTGGACTCATTTGGCCCTGTGAGAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077216 Essential Splice Site 916 1319 16 23
ENSDART00000098764   None 424 None 5
ENSDART00000134926   None 177 None 4
ENSDART00000141796   None 114 None 4
ENSDART00000145451 Essential Splice Site 311 714 6 13
Genomic Location (Zv9):
Chromosome 2 (position 34560339)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 34857049
GRCz11 2 34839506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACAAGTCCAACGCCAGCTGTGGTTGGAGTACCAGGATATCAGCAAAG[G/A]TAAGCCGATATAAATTATATTTATTTAAAAGACTGAACTTGCTGGTTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16944
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077216 Essential Splice Site 1101 1319 19 23
ENSDART00000098764   None 424 None 5
ENSDART00000134926   None 177 None 4
ENSDART00000141796   None 114 None 4
ENSDART00000145451 Essential Splice Site 496 714 9 13
Genomic Location (Zv9):
Chromosome 2 (position 34647072)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 34943782
GRCz11 2 34926239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCAGGAGAAGGTGACAGAGCGGACTGATCACTCCAAAGTTGAGACGG[G/A]TAAGCTTGAATAATRTACACATTCCCATCRGTGACCATAGAATAAACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link