zgc:153664

Ensembl ID:
ENSDARG00000068305
ZFIN ID:
ZDB-GENE-060825-75
Description:
28S ribosomal protein S14, mitochondrial [Source:RefSeq peptide;Acc:NP_001038823]
Human Orthologue:
MRPS14
Human Description:
mitochondrial ribosomal protein S14 [Source:HGNC Symbol;Acc:14049]
Mouse Orthologue:
Mrps14
Mouse Description:
mitochondrial ribosomal protein S14 Gene [Source:MGI Symbol;Acc:MGI:1928141]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19811 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098736 Nonsense 51 138 2 3
Genomic Location (Zv9):
Chromosome 2 (position 35314256)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 35610966
GRCz11 2 35593423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTCAGGAGCTACTATGTCGACTGGAGGATGTTGAGGGATGTGAAAAGA[C/T]GACAGATGGCTTTCGAATATGCAGATACACGACTGCGCATCAATGCCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link