
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153664
- Ensembl ID:
- ENSDARG00000068305
- ZFIN ID:
- ZDB-GENE-060825-75
- Description:
- 28S ribosomal protein S14, mitochondrial [Source:RefSeq peptide;Acc:NP_001038823]
- Human Orthologue:
- MRPS14
- Human Description:
- mitochondrial ribosomal protein S14 [Source:HGNC Symbol;Acc:14049]
- Mouse Orthologue:
- Mrps14
- Mouse Description:
- mitochondrial ribosomal protein S14 Gene [Source:MGI Symbol;Acc:MGI:1928141]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19811 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19811
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098736 | Nonsense | 51 | 138 | 2 | 3 |
- Genomic Location (Zv9):
- Chromosome 2 (position 35314256)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 35610966 GRCz11 2 35593423 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGTCAGGAGCTACTATGTCGACTGGAGGATGTTGAGGGATGTGAAAAGA[C/T]GACAGATGGCTTTCGAATATGCAGATACACGACTGCGCATCAATGCCATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: