zgc:77041

Ensembl ID:
ENSDARG00000068291
ZFIN ID:
ZDB-GENE-040426-2523
Description:
Transmembrane protein 208 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYP0]
Human Orthologue:
TMEM208
Human Description:
transmembrane protein 208 [Source:HGNC Symbol;Acc:25015]
Mouse Orthologue:
Tmem208
Mouse Description:
transmembrane protein 208 Gene [Source:MGI Symbol;Acc:MGI:1913570]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7604 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098712 Missense 116 175 5 6
Genomic Location (Zv9):
Chromosome 7 (position 53612582)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 51882432
GRCz11 7 52157502
KASP Assay ID:
554-4160.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGGCACCTAAAGGATGTCATTCTTCTTACTGCAATTGTCCAGGTGCTT[A/T]GCACTCTGTCATCCTACTTCTGGTACCTKTGGCTTCTGGTGAGACTGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link