slc7a4

Ensembl ID:
ENSDARG00000068286
ZFIN ID:
ZDB-GENE-030919-2
Description:
cationic amino acid transporter 4 [Source:RefSeq peptide;Acc:NP_919408]
Human Orthologue:
SLC7A4
Human Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc7a4
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 Gene [Source:MGI Symb

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21342 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098701 Nonsense 130 677 2 6

The following transcripts of ENSDARG00000068286 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 37616264)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36471815
GRCz11 8 36504249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGGCATTCCTGATTGGCTGGAATGTCATTTTGGAGTATATGATTGGC[G/T]GAGCGGCGGTAGCTCGTGCATGGAGTGGCTATCTGGACTCTATCTTTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link