
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-240b21.2
- Ensembl ID:
- ENSDARG00000068279
- ZFIN ID:
- ZDB-GENE-060526-125
- Description:
- Novel hAT family dimerisation domain protein [Source:UniProtKB/TrEMBL;Acc:A2BGL2]
- Human Orthologue:
- PRKRIR
- Human Description:
- protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
- Mouse Orthologue:
- Prkrir
- Mouse Description:
- protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repr
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa26445 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa26446 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa26445
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098684 | Nonsense | 294 | 643 | 3 | 7 |
ENSDART00000141368 | None | 222 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 5 (position 22476707)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 20189579 GRCz11 5 20693379 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGCACATCAACTCAACCTAATAATGCAACAGGCCACTTCTAACATTTCC[A/T]AAGTGAGAATTTTTTTTTTCTGACCTTGGAGGATTTTCCAGCTTTTTTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26446
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098684 | Nonsense | 308 | 643 | 4 | 7 |
ENSDART00000141368 | None | 222 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 5 (position 22476763)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 20189635 GRCz11 5 20693435 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAATTTTTTTTTTCTGACCTTGGAGGATTTTCCAGCTTTTTTTCAAGAT[C/A]ACCCAAACGCACAGACGTCCTTGATAAAGTAGTGGCCCATAGACTACCAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: