si:dkeyp-73c8.2

Ensembl ID:
ENSDARG00000068258
ZFIN ID:
ZDB-GENE-060503-749
Description:
Novel protein similar to vertebrate leucine-rich repeats and calponin homology (CH) domain containin
Human Orthologue:
LRCH4
Human Description:
leucine-rich repeats and calponin homology (CH) domain containing 4 [Source:HGNC Symbol;Acc:6691]
Mouse Orthologue:
Lrch4
Mouse Description:
leucine-rich repeats and calponin homology (CH) domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16430 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098622 Essential Splice Site 299 709 7 18
ENSDART00000148270 Essential Splice Site 301 681 7 17
Genomic Location (Zv9):
Chromosome 7 (position 62072146)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 61321888
GRCz11 7 61632050
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTATTGATTGTAATKTKTTTGAYGATTCATCTGTGTTGTTTCACTCT[A/G]GTCWGCTGATGATTTCTCTGAACGCTCGCTGCGATTGACAGATGTTTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link