zgc:103545

Ensembl ID:
ENSDARG00000068256
ZFIN ID:
ZDB-GENE-041010-61
Description:
RWD domain containing 4A [Source:RefSeq peptide;Acc:NP_001005985]
Human Orthologue:
RWDD4
Human Description:
RWD domain containing 4 [Source:HGNC Symbol;Acc:23750]
Mouse Orthologue:
Rwdd4a
Mouse Description:
RWD domain containing 4A Gene [Source:MGI Symbol;Acc:MGI:2681000]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21113 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21113
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073733 Essential Splice Site 176 187 6 8
ENSDART00000098616 Essential Splice Site 176 187 None 8
ENSDART00000128395 Essential Splice Site 176 187 None 9
ENSDART00000137762 Essential Splice Site 176 186 None 9
Genomic Location (Zv9):
Chromosome 7 (position 61755211)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 60973839
GRCz11 7 61284001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATAAGGGTGAACTGCCAAGAGGATGGAACTGGGTGGATGTTATTAAGG[T/G]AGGGTAACACGAGAAGATTTTACTATGAAAAGGCATTATTAAATTCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link