zgc:136906

Ensembl ID:
ENSDARG00000068238
ZFIN ID:
ZDB-GENE-060312-23
Description:
Dual specificity phosphatase DUPD1 [Source:UniProtKB/Swiss-Prot;Acc:Q29RA3]
Human Orthologue:
DUPD1
Human Description:
dual specificity phosphatase and pro isomerase domain containing 1 [Source:HGNC Symbol;Acc:23481]
Mouse Orthologue:
Dupd1
Mouse Description:
dual specificity phosphatase and pro isomerase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38227 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098580 Nonsense 89 126 2 2
Genomic Location (Zv9):
Chromosome Zv9_NA931 (position 1722)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150355.1 1722
GRCz11 KN150355.1 1722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTGGACACCGGCGCTGAATATTATAAAGATATGCAGATTCATTACTA[T/A]GGCGTCACAGCGGAGGACACGCCCACTTTCAACATCAGCCAATACTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link