si:dkey-224e22.3

Ensembl ID:
ENSDARG00000068219
ZFIN ID:
ZDB-GENE-061207-60
Description:
Novel protein similar to vertebrate UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 (B
Human Orthologue:
B3GNT8
Human Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 [Source:HGNC Symbol;Acc:24139]
Mouse Orthologue:
B3gnt8
Mouse Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 Gene [Source:MGI Symbol;Acc:MGI:238526

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8670 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098528 Nonsense 67 420 1 1
ENSDART00000131510 Nonsense 67 420 2 2
Genomic Location (Zv9):
Chromosome 18 (position 43124641)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44714532
GRCz11 18 44707986
KASP Assay ID:
2261-2576.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTTTAGTAAGCACTATCAAGAAACWAACCAAAGGTGTTGCACCATTC[A/T]AACTTCCACCGCTGACTATTTCYAACGATTTCAGAAAGWGCGTCCCCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link