si:dkey-245g2.3

Ensembl ID:
ENSDARG00000068217
ZFIN ID:
ZDB-GENE-091204-424
Human Orthologue:
STX2
Human Description:
syntaxin 2 [Source:HGNC Symbol;Acc:3403]
Mouse Orthologue:
Stx2
Mouse Description:
syntaxin 2 Gene [Source:MGI Symbol;Acc:MGI:108059]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15041 Nonsense Available for shipment Available now
sa12655 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098525 Nonsense 64 309 3 11
ENSDART00000132015 Nonsense 41 286 4 12
ENSDART00000143020 Nonsense 40 189 3 8
Genomic Location (Zv9):
Chromosome 8 (position 45914653)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44228836
GRCz11 8 44222255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTCCTCCCTAGTGGATGAGGTGAAGAAGAAAKATAGTGTGATCCTTT[C/A]GGCCCCCAATCCTGAWGAGAGTAAGTCACCCTTATGCACCTTTAGTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098525 Splice Site, Nonsense 121 309 6 11
ENSDART00000132015 Splice Site, Nonsense 98 286 7 12
ENSDART00000143020 Splice Site, Nonsense 97 189 6 8
Genomic Location (Zv9):
Chromosome 8 (position 45918936)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44224553
GRCz11 8 44217972
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATAYTTTCATGCCAAATTGGTTAATTGTGCTTCTTTTCTATTTCAGTA[T/A]ACTAATTTATCGCATAAATTTGTGGAAGTAATGACGCAATACAATGAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link