
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fzd10
- Ensembl ID:
- ENSDARG00000068213
- ZFIN ID:
- ZDB-GENE-990415-220
- Description:
- frizzled 10 isoform 2 [Source:RefSeq peptide;Acc:NP_571211]
- Human Orthologue:
- FZD10
- Human Description:
- frizzled homolog 10 (Drosophila) [Source:HGNC Symbol;Acc:4039]
- Mouse Orthologue:
- Fzd10
- Mouse Description:
- frizzled homolog 10 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2136761]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18678 | Nonsense | Available for shipment | Available now |
sa11027 | Nonsense | Available for shipment | Available now |
sa18927 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa7618 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa18678
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098520 | Nonsense | 71 | 580 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 8 (position 45838757)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 44304798 GRCz11 8 44298217 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CRAACTTAATGGRACATGAAGATCAAAATGAGGCAGCCATAAAGCTGCAT[G/T]AGTTTGCTCCGCTGATTGAGTTCGGCTGTCACAGCCATCTGAAGTTTTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11027
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098520 | Nonsense | 197 | 580 | 1 | 1 |
ENSDART00000098520 | Nonsense | 197 | 580 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 8 (position 45839135)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 44304420 GRCz11 8 44297839 - KASP Assay ID:
- 2260-1007.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACTGCCTATTAAAGAGAGGGTCGGTAAGACCACATGCAGCAACCCTGGA[A/T]AGTTTCATTATGTGCARARGAGTGAGTCCTGTRCCCCCAAGTGTTACTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18927
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098520 | Nonsense | 197 | 580 | 1 | 1 |
ENSDART00000098520 | Nonsense | 197 | 580 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 8 (position 45839135)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 44304420 GRCz11 8 44297839 - KASP Assay ID:
- 2260-1007.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACTGCCTATTAAAGAGAGGGTCGGTAAGACCACATGCAGCAACCCTGGA[A/T]AGTTTCATTATGTGCAAAAGAGTGAGTCCTGTGCCCCCAAGTGTTACTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7618
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098520 | Missense | 208 | 580 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 8 (position 45839168)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 44304387 GRCz11 8 44297806 - KASP Assay ID:
- 554-4357.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CATGCAGCAACCCTGGAAAGTTTCATTATGTGCARAAGAGTGAGTCCTGT[G/A]CCCCCAAGTGTTACTCCAACGTAGATGTGTACTGGAGCCAGGGCGACAAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Gambling: Genome-wide association study of a quantitative disordered gambling trait. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: