
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
haus6
- Ensembl ID:
- ENSDARG00000068210
- ZFIN ID:
- ZDB-GENE-030131-5517
- Description:
- HAUS augmin-like complex subunit 6 [Source:UniProtKB/Swiss-Prot;Acc:A0JMF7]
- Human Orthologue:
- HAUS6
- Human Description:
- HAUS augmin-like complex, subunit 6 [Source:HGNC Symbol;Acc:25948]
- Mouse Orthologue:
- Haus6
- Mouse Description:
- HAUS augmin-like complex, subunit 6 Gene [Source:MGI Symbol;Acc:MGI:1923389]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa41065 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa34221 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa21120 | Nonsense | Available for shipment | Available now |
sa5451 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa41065
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098503 | Essential Splice Site | 39 | 794 | 1 | 16 |
ENSDART00000133410 | None | 289 | None | 7 |
The following transcripts of ENSDARG00000068210 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 65681040)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 58862780 GRCz11 7 59165210 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGGATAACGTTTCCGTCACCAAAACAACGAAACATCTGAATCTGGGAATG[T/G]AAGTCTTATCTTTATTTTCTTCACATCCGAATAGCTTCTATGTTAGCCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34221
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098503 | Nonsense | 48 | 794 | 2 | 16 |
ENSDART00000133410 | None | 289 | None | 7 |
The following transcripts of ENSDARG00000068210 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 65680278)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 58862018 GRCz11 7 59164448 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCATGTTATTATATTTTTTTATAGGAACATGTTTGACAAACCAAACAAA[G/T]AGGCATTCTACATTGTCATTCACTTTTTATTTAATAAACTGAATCCCACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21120
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098503 | Nonsense | 378 | 794 | 10 | 16 |
ENSDART00000133410 | Nonsense | 40 | 289 | 1 | 7 |
The following transcripts of ENSDARG00000068210 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 65674903)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 58856643 GRCz11 7 59159073 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGATCAAGGTTTCCATTGGGAAGCTAGAGGAAGAATGGGAGTGCAAGTG[G/A]GCAAACTGTTTGAAAAATACACCCCTCACGTGTTTTCTTGAAGAGGATCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5451
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098503 | Essential Splice Site | 580 | 794 | 15 | 16 |
ENSDART00000133410 | Essential Splice Site | 242 | 289 | 6 | 7 |
The following transcripts of ENSDARG00000068210 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 65673202)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 58854942 GRCz11 7 59157372 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GATCCCTTTTCATCTAGGAAACAACTTTGCCGCACTCCTGAGAGTCTAAG[T/A]ATGTGTTTGGTAGCCTAAACAWGTAGTATTCTCTACTTTATTAGAAATGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: