Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-201c13.3
- Ensembl ID:
- ENSDARG00000068194
- ZFIN ID:
- ZDB-GENE-060526-244
- Description:
- hypothetical protein LOC565869 [Source:RefSeq peptide;Acc:NP_001122201]
- Human Orthologue:
- KLF9
- Human Description:
- Kruppel-like factor 9 [Source:HGNC Symbol;Acc:1123]
- Mouse Orthologue:
- Klf9
- Mouse Description:
- Kruppel-like factor 9 Gene [Source:MGI Symbol;Acc:MGI:1333856]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa9385 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa40427 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa11647 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9385
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000098473 | Nonsense | 33 | 216 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 5 (position 27720212)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 25475510 GRCz11 5 26075663 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACGTCGAGCGCTCCGACAAACTAACCGGCGAGGAGGGGTCTGAAGAAAGT[C/T]AAGAAAGCCGGAYTCTGTTGATGGTCGCAATGATTCTGCTGGACTTAAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40427
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000098473 | Nonsense | 48 | 216 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 5 (position 27720258)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 25475556 GRCz11 5 26075709 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTCAAGAAAGCCGGACTCTGTTGATGGTCGCAATGATTCTGCTGGACT[T/G]AAACCAGTGCATACCGAGCGGCATCAGCGCCAAGCGAATAGTGGACAGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11647
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000098473 | Nonsense | 103 | 216 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 5 (position 27720424)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 25475722 GRCz11 5 26075875 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAKCGCGACCGACTGCACGCATCCGCGGAGAAAAGACACTGCTGCCCGTA[T/A]GCAGGCTGTGGTAAAATATACGGCAAGTCTTCCCATCTGAAGGCGCACTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Body mass index: Common variants at CDKAL1 and KLF9 are associated with body mass index in east Asian populations. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
