wu:fd15f08

Ensembl ID:
ENSDARG00000068187
ZFIN ID:
ZDB-GENE-030131-5391
Human Orthologue:
SPG7
Human Description:
spastic paraplegia 7 (pure and complicated autosomal recessive) [Source:HGNC Symbol;Acc:11237]
Mouse Orthologue:
Spg7
Mouse Description:
spastic paraplegia 7 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:2385906]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25370 Nonsense Mutation detected in F1 DNA During 2018
sa10238 Nonsense Available for shipment Available now
sa17610 Nonsense Available for shipment Available now
sa34201 Nonsense Mutation detected in F1 DNA During 2018
sa41039 Nonsense Mutation detected in F1 DNA During 2018
sa21092 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098438 Nonsense 13 788 1 17
Genomic Location (Zv9):
Chromosome 7 (position 57443594)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55878920
GRCz11 7 56180331
KASP Assay ID:
554-7572.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGTTTTTAACATGGCAGCGCTACTTCTGCAGCGTGGAAACACATGTTA[T/G]AGCAAACGGTTTTGGTCGCTGTCGTCTCGTTTTAGCTGTTTTCAGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098438 Nonsense 122 788 4 17
Genomic Location (Zv9):
Chromosome 7 (position 57437517)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55872843
GRCz11 7 56174254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTATGCATTCTTCRCTTTTGTTGTTTCTTCCCTAGAAGAGAAAAAGAGA[C/T]GAGAACAGGAGGATCAGATGTACAGGGAACGRCTGCGCACACTCTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17610
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098438 Nonsense 124 788 4 17
Genomic Location (Zv9):
Chromosome 7 (position 57437511)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55872837
GRCz11 7 56174248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCTTCRCTTTTGTTGTTTCTTCCCTAGAAGAGAAAAAGAGAYGAGAA[C/T]AGGAGGATCAGATGTACAGGGAACGRCTGCGCACACTCTTTATTATCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34201
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098438 Nonsense 166 788 4 17
Genomic Location (Zv9):
Chromosome 7 (position 57437384)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55872710
GRCz11 7 56174121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACACCAGTGGCGGTAACATATCCTGGAACGATTTTGTGAATGAAATGT[T/A]GGCCAAAGGGGAGGTGTCGCGAGTACAGGTGGTCCCAGAGAGTGACATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41039
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098438 Nonsense 318 788 7 17
Genomic Location (Zv9):
Chromosome 7 (position 57435679)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55871005
GRCz11 7 56172416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCAGGAATGCGCGAGGCCAAGATGGAAGTCAAAGAGTTTGTGGATTA[T/A]CTCAAGGTAAGAAAGTCCAAAACATGATTAGACTGAGTCGAGTAGGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098438 Nonsense 542 788 12 17
Genomic Location (Zv9):
Chromosome 7 (position 57425607)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 55860933
GRCz11 7 56162344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGGGCTTCAAGTCCATCGACACCTTCAGCTTTGAATATGCTGTGGAA[A/T]GAGTCATTGCAGGTTTCTAGCTGCTAGATTAATGTGTGCTTTTGATTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link