zgc:153024

Ensembl ID:
ENSDARG00000068181
ZFIN ID:
ZDB-GENE-061013-388
Description:
dipeptidase 1 [Source:RefSeq peptide;Acc:NP_001070805]
Human Orthologue:
DPEP1
Human Description:
dipeptidase 1 (renal) [Source:HGNC Symbol;Acc:3002]
Mouse Orthologue:
Dpep1
Mouse Description:
dipeptidase 1 (renal) Gene [Source:MGI Symbol;Acc:MGI:94917]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41044 Nonsense Mutation detected in F1 DNA During 2018
sa38644 Nonsense Mutation detected in F1 DNA During 2018
sa12336 Nonsense Available for shipment Available now
sa11794 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098430 Nonsense 9 413 1 11
Genomic Location (Zv9):
Chromosome 7 (position 57878937)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56314263
GRCz11 7 56615674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTGGCTAAATAGTGTGGTGATGATGGAATGGGTCAAGATTTTATGTT[T/A]AGTGCTCTTGGTTTTCTCATTCAGCTCTGAAGCAGATGAATTGATGGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098430 Nonsense 165 413 4 11
Genomic Location (Zv9):
Chromosome 7 (position 57887537)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56322863
GRCz11 7 56624274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGCAGTCTGGGTACTCTGCGCACCATGTACCAGCTGGGGGTTCGATA[T/A]CTTACTCTCACACACAGCTGCAACACACCCTGGTGAGTGGCTTTACTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098430 Nonsense 180 413 5 11
Genomic Location (Zv9):
Chromosome 7 (position 57888583)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56323909
GRCz11 7 56625320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTCCATTACTACATTGTAATCTCACTTCCTTCTAGGGCAGACAACTG[G/A]CTRATGGACACAGAATCTAATCCTGTGAGAAATWTTGGTTTGTCTGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098430 Nonsense 323 413 9 11
Genomic Location (Zv9):
Chromosome 7 (position 57899886)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56335212
GRCz11 7 56636623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTATGTTTTGAYCAGGGTGCCGGTTGGTCTAGAAGATGTGTCAAAGTR[T/A]CCAGACCTGGTGGTTGAACTTCTCAGGCGTGGTTGGTCAGATAATGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link