
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153024
- Ensembl ID:
- ENSDARG00000068181
- ZFIN ID:
- ZDB-GENE-061013-388
- Description:
- dipeptidase 1 [Source:RefSeq peptide;Acc:NP_001070805]
- Human Orthologue:
- DPEP1
- Human Description:
- dipeptidase 1 (renal) [Source:HGNC Symbol;Acc:3002]
- Mouse Orthologue:
- Dpep1
- Mouse Description:
- dipeptidase 1 (renal) Gene [Source:MGI Symbol;Acc:MGI:94917]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa41044 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa38644 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa12336 | Nonsense | Available for shipment | Available now |
sa11794 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa41044
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098430 | Nonsense | 9 | 413 | 1 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 57878937)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 56314263 GRCz11 7 56615674 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGTGGCTAAATAGTGTGGTGATGATGGAATGGGTCAAGATTTTATGTT[T/A]AGTGCTCTTGGTTTTCTCATTCAGCTCTGAAGCAGATGAATTGATGGACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38644
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098430 | Nonsense | 165 | 413 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 57887537)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 56322863 GRCz11 7 56624274 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACAGCAGTCTGGGTACTCTGCGCACCATGTACCAGCTGGGGGTTCGATA[T/A]CTTACTCTCACACACAGCTGCAACACACCCTGGTGAGTGGCTTTACTCGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12336
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098430 | Nonsense | 180 | 413 | 5 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 57888583)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 56323909 GRCz11 7 56625320 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTTTCCATTACTACATTGTAATCTCACTTCCTTCTAGGGCAGACAACTG[G/A]CTRATGGACACAGAATCTAATCCTGTGAGAAATWTTGGTTTGTCTGAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11794
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098430 | Nonsense | 323 | 413 | 9 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 57899886)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 56335212 GRCz11 7 56636623 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATTATGTTTTGAYCAGGGTGCCGGTTGGTCTAGAAGATGTGTCAAAGTR[T/A]CCAGACCTGGTGGTTGAACTTCTCAGGCGTGGTTGGTCAGATAATGAGAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: