zgc:153206

Ensembl ID:
ENSDARG00000068176
ZFIN ID:
ZDB-GENE-060929-1034
Description:
ubiquinol-cytochrome c reductase complex chaperone [Source:RefSeq peptide;Acc:NP_001070223]
Human Orthologue:
UQCC
Human Description:
ubiquinol-cytochrome c reductase complex chaperone [Source:HGNC Symbol;Acc:15891]
Mouse Orthologue:
Uqcc
Mouse Description:
ubiquinol-cytochrome c reductase complex chaperone, CBP3 homolog (yeast) Gene [Source:MGI Symbol;Acc

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26839 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098421 Essential Splice Site 98 286 3 9
Genomic Location (Zv9):
Chromosome 6 (position 52510693)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52559946
GRCz11 6 52559072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGATTGAGGCCATGGGCTTCACCGGACCCCTCAAATACAACAAATGGG[T/G]AAATAAAGCCGCTCATCCAGTGTTTCTAAGCAGTAGATGACATTTGGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: Identification of ten loci associated with height highlights new biological pathways in human growth. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Height: Meta-analysis of genome-wide scans for human adult stature identifies novel Loci and associations with measures of skeletal frame size. (View Study)
  • Spine bone size: Genome-wide association study identified UQCC locus for spine bone size in humans. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link