
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ehmt1a
- Ensembl ID:
- ENSDARG00000068157
- ZFIN ID:
- ZDB-GENE-040724-44
- Description:
- histone-lysine N-methyltransferase, H3 lysine-9 specific 5 [Source:RefSeq peptide;Acc:NP_001025302]
- Human Orthologue:
- EHMT1
- Human Description:
- euchromatic histone-lysine N-methyltransferase 1 [Source:HGNC Symbol;Acc:24650]
- Mouse Orthologue:
- Ehmt1
- Mouse Description:
- euchromatic histone methyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1924933]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18521 | Essential Splice Site | Available for shipment | Available now |
sa40453 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa7277 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa26489 | Essential Splice Site, Missense | Mutation detected in F1 DNA | During 2018 |
sa25299 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa18521
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098364 | None | 1059 | None | 23 | |
ENSDART00000125042 | None | 759 | None | 20 | |
ENSDART00000125175 | Essential Splice Site | None | 321 | None | 11 |
ENSDART00000126018 | Essential Splice Site | None | 1058 | None | 24 |
ENSDART00000126880 | None | 807 | None | 21 |
- Genomic Location (Zv9):
- Chromosome 5 (position 31153120)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 28914477 GRCz11 5 29514630 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAACTTTTGAGAWATTGTACAAAAATGCAAGCCATTAKAAGTTAGCCGG[T/A]AAGTATGCRCTAAGCYGCTGWAATTGCAATATGTGAGAWATCTCTAGCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40453
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098364 | Essential Splice Site | 174 | 1059 | 3 | 23 |
ENSDART00000125042 | None | 759 | None | 20 | |
ENSDART00000125175 | None | 321 | None | 11 | |
ENSDART00000126018 | Essential Splice Site | 174 | 1058 | 4 | 24 |
ENSDART00000126880 | None | 807 | None | 21 |
- Genomic Location (Zv9):
- Chromosome 5 (position 31149106)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 28910463 GRCz11 5 29510616 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACAGCATCTCAGTTTACCTCAGGAACTCAAAGACTCCACACAAACAGG[T/A]GGGATTTTTAGTTAAAAAGCTAAGCATAATTAAATGATATTGTTTAGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7277
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098364 | None | 1059 | None | 23 | |
ENSDART00000125042 | Essential Splice Site | 152 | 759 | 5 | 20 |
ENSDART00000125175 | None | 321 | None | 11 | |
ENSDART00000126018 | None | 1058 | None | 24 | |
ENSDART00000126880 | Essential Splice Site | 200 | 807 | 6 | 21 |
- Genomic Location (Zv9):
- Chromosome 5 (position 31144120)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 28905477 GRCz11 5 29505630 - KASP Assay ID:
- 554-5452.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGCAAAATAGGTTATTTTAAAAAGTTGGCTTTTATGTYAMAAGATTTAT[G/A]TAAACAAAGCTCACTATGAGCGCTCTTGTWATTGACCTAAACTTTTTGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26489
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site, Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098364 | Missense | 718 | 1059 | 16 | 23 |
ENSDART00000125042 | Missense | 420 | 759 | 13 | 20 |
ENSDART00000125175 | Essential Splice Site | None | 321 | 4 | 11 |
ENSDART00000126018 | Missense | 718 | 1058 | 17 | 24 |
ENSDART00000126880 | Missense | 468 | 807 | 14 | 21 |
- Genomic Location (Zv9):
- Chromosome 5 (position 31136942)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 28898299 GRCz11 5 29498452 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTTCATGGAAATGCTCTTCTCTAGGTTGTTTCTGTCTCGAGGAGCGGA[T/A]GTAAACCTGAAGAACAGAGATGGCGAAACTCCTTTGGGCTGCTGTAATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25299
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000098364 | Nonsense | 965 | 1059 | 22 | 23 |
ENSDART00000125042 | Nonsense | 671 | 759 | 19 | 20 |
ENSDART00000125175 | Nonsense | 227 | 321 | 10 | 11 |
ENSDART00000126018 | Nonsense | 964 | 1058 | 23 | 24 |
ENSDART00000126880 | Nonsense | 719 | 807 | 20 | 21 |
- Genomic Location (Zv9):
- Chromosome 5 (position 31130555)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 28891912 GRCz11 5 29492065 - KASP Assay ID:
- 554-7768.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGTTAGCAGGTTTATGAATCATCTTTGTGAGCCCAATCTATTCCCAGTA[C/T]GAGTGTTCACCAAACATCAAGACATGCGCTTTCCTCGTATTGCATTCTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: