si:dkey-77f17.1

Ensembl ID:
ENSDARG00000068152
ZFIN ID:
ZDB-GENE-050419-182
Description:
Novel protein similar to mucosa associated lymphoid tissue lymphoma translocation gene 1 (Malt1) [So
Human Orthologue:
MALT1
Human Description:
mucosa associated lymphoid tissue lymphoma translocation gene 1 [Source:HGNC Symbol;Acc:6819]
Mouse Orthologue:
Malt1
Mouse Description:
mucosa associated lymphoid tissue lymphoma translocation gene 1 Gene [Source:MGI Symbol;Acc:MGI:2445

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6521 Nonsense Mutation detected in F1 DNA During 2018
sa36661 Essential Splice Site Mutation detected in F1 DNA During 2018
sa10751 Essential Splice Site Available for shipment Available now
sa36660 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098368 Nonsense 46 667 2 14
ENSDART00000142043 Nonsense 46 627 3 15
Genomic Location (Zv9):
Chromosome 18 (position 26656526)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26729781
GRCz11 18 26712159
KASP Assay ID:
554-4928.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCGTTGCCTGTTTGTGTACCACCAAACCATGAGGTAACTTTAAGGGTT[C/T]AAGCAAAAGGCACTGGTGCACTGAAATATCAGTGGTTTGATAAACAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098368 Essential Splice Site 200 667 5 14
ENSDART00000142043 Essential Splice Site 200 627 6 15
Genomic Location (Zv9):
Chromosome 18 (position 26652314)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26725569
GRCz11 18 26707947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAATATTTTGGAGGAGAGATGGTCTGAAGCAGCTGAAATTGAGATTGG[T/A]AAGAGTGACATCATTCCTTTGTTTAATTTTAACTGCAATGATTAATCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098368 Essential Splice Site 509 667 12 14
ENSDART00000142043 Essential Splice Site 509 627 13 15
Genomic Location (Zv9):
Chromosome 18 (position 26631253)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26704508
GRCz11 18 26686886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGAGCGCCRTGGCCCAGGACTGCACTCTCATTCTTGAAAGCGAACCAG[T/A]AAGTCACAGCTTTTTCATGTCCTCTTTTGCTGACATAAACACATACACAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098368 Nonsense 518 667 13 14
ENSDART00000142043 Nonsense 518 627 14 15
Genomic Location (Zv9):
Chromosome 18 (position 26627549)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26700804
GRCz11 18 26683182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGACATGTTTTTTTTGTTTTTAGAATCTGCAGGACATTTTCTCAGCTT[C/A]GGGCAGATCAGAGGAAATGGACTCCTTGTTTGTGAGCGGTGGTCAAACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link