slc39a6

Ensembl ID:
ENSDARG00000068143
ZFIN ID:
ZDB-GENE-030131-3023
Description:
zinc transporter ZIP6 [Source:RefSeq peptide;Acc:NP_001001591]
Human Orthologue:
SLC39A6
Human Description:
solute carrier family 39 (zinc transporter), member 6 [Source:HGNC Symbol;Acc:18607]
Mouse Orthologue:
Slc39a6
Mouse Description:
solute carrier family 39 (metal ion transporter), member 6 Gene [Source:MGI Symbol;Acc:MGI:2147279]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39905 Nonsense Mutation detected in F1 DNA During 2018
sa13051 Nonsense Available for shipment Available now
sa12042 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098357 Nonsense 221 742 2 11
ENSDART00000144707 Nonsense 185 241 2 3
Genomic Location (Zv9):
Chromosome 2 (position 42271732)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42321196
GRCz11 2 42170614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTACCAGATCACGGCGGACCAATCGCAGCGCCGATTATGATTTTACA[C/T]AGGACCACGCCTCCTTTAGCCCCAGTCAGCCCAATGTGACACACTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13051
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098357 Nonsense 265 742 3 11
ENSDART00000144707 Nonsense 229 241 3 3
Genomic Location (Zv9):
Chromosome 2 (position 42269683)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42319147
GRCz11 2 42168565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCCCTNNNNNNNNNCACTCATATAACTCCTCYCTTTTCACTTTCAGTG[T/A]CAAAATGCCTCCACGATCCTGCAGACGCATGGCATGAGAAAGGAAGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098357 Nonsense 668 742 10 11
ENSDART00000144707   None 241 None 3
Genomic Location (Zv9):
Chromosome 2 (position 42260002)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42309466
GRCz11 2 42158884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTGATGGGATATCTGGGCATGATCATCGGGATTCTCATCGGACATTA[T/A]GCTGAAAATGTTGCCACATGGATCTTTGCTCTCACAGCTGGGTTRTTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link